Psomagen, Inc. provides service or product in accordance with the following terms and conditions (the "Terms") at the client's request.
1. Purpose
The purpose of the Terms is to establish the rights and obligations of Psomagen and Client with respect to Psomagen's service or product as requested or ordered by Client. Psomagen and Client shall faithfully perform their duties as specified in these Terms.
2. Definition
Unless specified otherwise in these Terms, the following terms have the meanings set forth herein.
- "Client" is a company or a person who orders service or product, and "Psomagen" is the provider of the service or product to Client.
- "Result" means the result of an analysis ordered by Client.
- "Product" means goods that Psomagen provides as ordered by Client and includes product or products.
- "Service" means doing work for Client by Psomagen as ordered and includes service or services.
- "Completion date" means the date on which Client pays an invoice and Psomagen provides the result of the service or ships the product ordered by Client.
- “Written form” or "in writing" includes not only general written documents, but also electronic documents and other digital formats.
- “Business days” means Monday to Friday excluding Saturday, Sunday and Psomagen holidays.
3. Contents and Scope of the Terms
- If Client needs any additional service or product or the parties desire to make any changes to the Terms, Psomagen and Client will enter into a separate agreement to provide such additional service or product (price and payment terms will also be included) and to make changes to these Terms.
- The terms and conditions of the separate agreement shall take precedence over these Terms, and the agreement shall be made in the written form.
4. Term
These Terms shall become effective as of the date when Client places an order and shall remain in full force and effect till the completion date unless agreed otherwise.
5. Approval of Result and Payment
- Psomagen shall invoice Client on the completion date. Client shall pay for the service or product provided by Psomagen within 30 days from the invoice date.
- If Psomagen cannot provide any service or product due to client's circumstances, misconduct, or negligence, or the information provided by Client has any problems (such as incorrect address or email address), the date when Psomagen is ready to provide the analysis result or ship the product will be deem to be the completion date.
- Psomagen's invoice includes taxes which are generally imposed on sales of product or service, including VAT; provided, however, that if any additional taxes or import taxes are imposed based on the Circumstances of Client, Client shall pay those taxes.
- If an invoice is not paid in full within thirty (30) days from the invoice date, any balances not paid will be subject to a ten percent (10% per annum) late payment penalty unless the parties enter into a separate written agreement.
- Client agrees that, if Client does not pay an outstanding invoice within the due date, Psomagen may hire a collection agency to recover unpaid balances.
- Client shall inspect the result or product within 10 business days from the date of receipt and notify Psomagen if there is any defects or problems. If Psomagen has not given such notification within such time period, the result or product is deemed to have no defects or problems.
- If Client notifies Psomagen of any defects or problems of the result or product, within the aforementioned time period and the parties agree that such defects or problems needs to be fixed or that sample reanalysis or a new product needs to be provided, Psomagen shall provide reanalysis result or a new product within the time period agreed by the parties.
- If re-analysis of the service result or re-supply of the new product set forth in Section 5.7 is caused by Client (such as provision of defective samples), Client shall bear the additional cost.
- When Client orders a service or a product for which the price is not confirmed at the time of placement of the order, Psomagen shall invoice on the date on which Psomagen provides the sercice result or ships the product. If Client disputes any invoiced charges, Client shall notify Psomagen of the disputed items within five (5) business days from the invoice date. If Client does not notify Psomagen of the disputed items within such period, the invoice is deemed to be accepted by the Client.
6. Storage of Samples and Analysis Results
-
Psomagen, based on its internal policy, stores samples and related data for the period as specified in the following table unless requested otherwise by Client.
Service name Samples and Primers data CES 30 days 3 years NGS 3 months 3 months Clinical 3 months 3 months Nanopore SEQ 30 days 3 months - Psomagen will destroy the samples and related data when the period of time specified in the table above expires.
- Psomagen, based on its internal policy, stores the samples and related data into commonly used storage protocols with reasonable care in the relevant industry unless requested otherwise by Client.
- If Client needs additional storage or additional storage period, Client shall notify Psomagen in advance. if additional storage or additional storage period incurs any additional costs, Psomagen shall notify Client of the costs and other relevant conditions.
- If Client requests destruction of samples or data, Psomagen shall faithfully perform the destruction procedure; provided, however, that Client shall request the destruction in writing.
7. Information Security
- Psomagen complies with Personal Information Protection Act, Bioethics and Safety Act, and other applicable laws and regulations related to processing orders and complies with all relevant laws and regulations of the Republic of Korea in respect of the sample analysis and storage of data.
- If laws of other countries are applied to the analysis or storage of data, Psomagen shall comply with those laws and regulations only if Client provides relevant information or requests such compliance.
8. Faithful Performance and Mutual Cooperation
- Client and Psomagen shall faithfully perform their duties under these Terms.
- Client and Psomagen may discuss client's order from time to time and shall cooperate with each other if necessary.
9. Confidentiality
- Each of the Parties agrees to keep strictly secret and confidential and use Confidential Information, including information related to each party's business management, trade secrets, technology, Clients, sample providers and any other information that should reasonably be recognized as Confidential Information ("Confidential Information"), only for the purpose of processing the order pursuant to these Terms. Notwithstanding anything in the foregoing to the contrary, each party may disclose Confidential Information pursuant to any law or legal procedure, provided that each party promptly notifies the other party in writing of such demand for disclosure.
- Each party shall not directly or indirectly disclose Confidential Information to any third party without the prior written consent of the other party.
- Each party shall not disclose Confidential Information to any third party, except the minimum number of employees who need to know such Confidential Information to process the order pursuant to these Terms.
- The obligations specified in Sections 9.1, 9.2, and 9.3 shall not apply to any Information which, as the Receiving Party shall demonstrate, by substantial supporting documents, at the time of disclosure:
- is already known to the Receiving Party;
- is received independently by the Receiving Party from a third party free to lawfully disclose such information to the Receiving Party;
- is independently developed by the Receiving Party without use of the Confidential Information; or
- is already in the public domain or in the future becomes part of the public domain, through no breach of these Terms.
- The obligations set forth in this Article shall remain in effect for two (2) years after the date of termination or expiration of these Terms.
10. Termination and Indemnification
- Each Party shall have the right to terminate the order and claim damages
- if the other Party or its creditors or any other eligible party files for its liquidation, bankruptcy, reorganization, composition or dissolution, or if the other Party is unable to pay any kind of debts as they become due, or the creditors of the other Party have taken over its management;
- if either party violates these Terms intentionally or by gross negligence or damages or destroys the other party or any third party's fame or property;
- if either party suspends performance of these Terms without good cause or interferes with the processing of the order;
- if the order cannot be processed due to natural disasters, economic circumstances, sudden changes in financial conditions, or other reasons for the event of force majeure; or
- if, during the period of these terms, either party does not cooperate with the other party to accomplish the purpose of these Terms or it is reasonably considered to be difficult to expect such cooperation.
- If either party makes any material breach of any terms or conditions of these Terms and fails to cure such breach within ten (10) business days after receiving written notice to cure from the other party, the other party may terminate the order pursuant to these terms.
- If the order is terminated pursuant to this Article, the party caused the termination shall indemnify the other party from all damages, costs, liabilities and expenses arising out of or resulting from the termination. Termination of Order does not mean an exemption from the liability for damages unless agreed otherwise.
- Other than the termination of these Terms pursuant to this Article, if either party has incurred damages to the other party in violation of any terms or conditions of these Terms, the party caused damages shall indemnify the other party from all such damages; provided, however, that Psomagen's Indemnifiable Costs will not exceed the total amount paid by Client for each order.
11. Technical Support and Consulting Service
After placing an order, Client may request and receive additional technical support or consulting service from Psomagen. In the event that such support or service incur any additional costs, Psomagen shall notify and discuss with the client in advance.
12. Dispute Resolution
- These Terms shall be governed by and construed in accordance with the laws of the Republic of Korea.
- Any disputes arising out of or in connection with these Terms shall be finally settled by arbitration in accordance with the International Arbitration Rules of the Korean Commercial Arbitration Board. The place of arbitration will be Seoul, Republic of Korea. The award rendered by the arbitrator(s) shall be final and binding upon the parties concerned.
13. General
- Client agrees that these Terms apply to all service and product orders by Client through Psomagen's Online Ordering System; Provided, however, if Psomagen and Client enter into any separate agreement, the agreement takes precedence over these Terms.
- Client has read and understood the main contents of these Terms and Conditions prior to placing an order and agrees that these Terms will apply to the order.
- When there is any changes to these Terms, Psomagen will notify Client of such changes through email or Psomagen's website. Revised Terms and Conditions will be applied to the orders placed after the effective date of those Terms.
- If any Client disputes any part of the revised Terms, the Client shall notify Psomagen, and Psomagen shall take necessary measures (such as deleting the Client's account) to prevent the revised Terms from being applied to the Client.
Order Information
- Order Number
- -
- Customer Name
- -
| Sample |
|
||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Primer |
|
Order Summary
*Pricing is estimated. Actual charge on the invoice may differ upon completion of the work
*Discount coupons or promo codes do not apply to shipping costs.
Sanger Sequencing
The “Gold Standard of Sequencing” is offered as a service with fast turnaround time, quality of results, and competitive prices.
Our automated systems allow rapid and accurate processing.
Samples can be submitted in premixed state or template/primer separately for single tube, plate, or colonies.
Sequencing Services
Standard sequencing is a service that sequences PCR products and plasmid DNA requested by customers.
Psomagen provides quicker and more accurate services based on the Capillary Electrophoresis Sequencing (CES)
automation system and extensive experience.
After the results are delivered, an expert in the sequencing field is ready to provide help until the follow-up.
- - ABI 3730xl System
- High quality results, Normal read length (800bp)
- Real-time monitoring is possible from order receipt to delivery of the results based on Laboratory Information
Management System (LIMS)
- Results provided within 24 hours of sample receipt
- Free universal primer
Standard Sequencing
- Standard Sequencing
-
Psomagen offers DNA sequencing using state-of-the-art robotics and instrumentation to generate high quality sequence data at affordable prices.
We have successfully sequenced countless samples of PCR products, plasmids, and BACs from clients all over the world.
Our DNA sequencing services are highly rated for fast turnaround time, quality of results, and competitive prices.
Standard Sequencing Single / Plate
Standard sequencing can be performed with single tubes and 96-well plates.
- Single Tube Order
- We accept clones, plasmids DNA, un-purified and purified PCR Products in 1.5 ml microcentrifuge tubes or 8-strips.
This option is recommended for less than 60 samples.
Samples can be submitted in premixed state or template/primer separately. - Plate Order
- For large number of samples over 60, we recommend using this option.
We accept clones, plasmids, un-purified or purified PCR Products in 96-well plate as well.
Samples can be submitted in premixed state or template/primer separately. - * Note:
· Well-to-well difference in concentration may impact quality of result for plate orders.
When preparing samples, please be advised to have the concentration consistent throughout the plate as much as possible.
· Free retrial is not available for plate sequencing service. Any retrial request will be regarded as a new order and charged accordingly. - 1 Primer / 1 Plate
- "1 Primer / 1 Plate" refers to plate sequencing using one primer throughout the plate. Individual sample name is not required but only the plate name.
The result will be provided in the order of [plate-name]-[well-position]-[primer-name] as shown below: - ex)
HCVNS5B-H05_SP6.ab1
BRCA2-D24_T7.ab1 - In order to utilize this service, the following criteria must be met:
- · Samples must be submitted in a 96-well plate.
· Only a single primer must be used to the entire plate. - Multiple Primer / 1 Plate
- "Multiple Primer / 1 Plate" service allows multiple primers to be used in a 96-well plate.
For example, the first 48 samples can be sequenced using a forward primer and the other 48 samples can be sequenced using a reverse primer.
Extra charge will be applied for each additional primer.
In case of using three or more primers in a plate, we highly recommend sending us the DNA template and primer premixed in a plate or arranging primers in a separate plate that pairs with the templates.
Difficult Sequencing
Psomagen offers DNA sequencing for difficult templates with high GC or GT, unusual secondary structure or hairpin structures.
With over 20 years of experiences, we have optimized our protocol to yield successful sequencing data for these difficult templates.
- Psomagen provides premium protocol for difficult template sequencing.
- · High GC or GT
· Unusual secondary structure
· Repetitive sequence
· siRNA with hairpin structure
· Homopolymeric tracts (PolyA, PolyG) -
Example
Primer Walking
Psomagen offers primer walking service to confirm the sequence integrity of your clone or PCR products.
We can perform end sequencing with the primers that you provide or use the reference sequence, if applicable, and design internal primers to fill in the gap.
- Primer walking service is a useful method to obtain sequence of size 2~10kb.
- For bigger size than above or large construct DNA, we would like to recommend shotgun sequencing to save time and cost.
- · 1Kb single contig : 5~6 days.
(Time consuming would vary based on the following reasons; primer synthesis and sequencing failure)
· Phred score of 20 or higher quality contig is required.
· Time can be saved when primers are synthesized bidirectionally.
(refer to the figure as follows) -
Template
- Starting with the end sequencing product by using the primer provided or designed, internal primer will be designed and processed.
Using a new primer (but with the same template), internal primer continues reading at the appropriate location.
Each walking requires approximately 5~6 days; enabling extension of 500bp~600bp per direction.
- Result
- Number of primers and sequence used for primer walking
AB1 file used for primer walking
Contig sequence and contig quality
EZ-Seq
EZ-Seq is pre-paid DNA sequencing services devised to eliminate complicated ordering process.
Instead of filling out an order sheet for sample and primer information, you are only asked to enter the number of reactions you would like to request.
You will be given a barcoded label per each tube or plate which will serve as an identifier for your sample(s).
Samples must be in premixed state and in-house universal primers cannot be used for Ez-Seq.
Barcoded label will be provided upon receiving payment.
- EZ-Seq Service
- · EZ-Seq single direct
Each sequencing reaction has one single label assigned. Re-run service is NOT included.
· Ez-Seq plate direct
A single label is assigned for one 96-well plate. Re-run service is NOT included.
The well position will be used as the identifier of the samples.
-
How to use EZ-Seq
- How to prepare samples
- · 5µl of 50ng/µl PCR product + 5µl of 5pmole/µl primer
· 5µl of 100ng/µl plasmid + 5µl of 5pmole/µl primer - How to use the barcode labels
- A barcode label is made of two parts.
One is for your own record keeping, and the other one is for attaching on the tubes or plates. -
- When attaching the labels on your tubes, please start from the arrow side and roll it around so the label can overlap itself.
For plate label, please attach anywhere on the top of the lid.
It is important to make the barcode visible in order to scan properly.
The invoice enclosed in the shipping package along with the labels.
You may purchase labels ahead of time and you may share them with your colleagues. - When submitting samples, please include the email address to which the results should be sent.
Otherwise, all results will be sent to the email address of the account holder to whom the labels were originally issued.
RCA (Direct Colony Sequencing)
Unlike the traditional method of Plasmid Purification, RCA does not need overnight culturing or other time-consuming purification steps. The final product from the RCA step can be directly implemented for Sanger sequencing.
RCA offers a powerful and highly sensitive isothermal DNA amplification method. It enables continuous amplification of circular DNA templates, producing long and repetitive copies.
RCA’s streamlined process eliminates the necessity for overnight culturing, significantly reducing the overall time and complexity of DNA preparation.
- Starting Material
-
Bacterial colonies with circular templates in glycerol or agar plates (BSL1 Only)
*Linear templates will not be acceptable for RCA
- Sample Submission
-
Agar-stab/Agar-plate: Label each colony to be picked. Samples can be shipped in room temperature
Glycerol stock: Submit glycerol stock in single tubes or 96 well plates. Samples should be enclosed in dry ice.
-
processing of RCA
Customized Sequencing
We have been dedicating to provide genomic solutions to researchers in all over the world with its advanced DNA sequencing technology by using ABI 3730XLs. Thanks to over 20 years long know-how and large genomics facility, we are able to provide our sequencing service from small scale sequencing reactions to large sequencing projects, we are ready to serve you with our pleasure.
PCR Amplification/Optimization
Psomagen performs PCR service with the template and the primer set to be provided by customer.
PCR condition, primer Tm value, predicted product size, primer concentration, and template concentration are required.
We conduct PCR optimization process for each primer set for high quality of PCR products from gDNA.
Primer design and synthesis can also be done with extra charge
Identification
16S/18S/28S rRNA and ITS region full sequencing is a service that analyzes sequences
by amplifying ribosomal RNA genes of bacteria and fungi (filamentous fungus and yeast)
and confirming homology of target microorganisms using an rRNA database (NCBI).
Psomagen controls and performs all processes from gDNA extraction of bacteria
and fungi (filamentous fungus and yeast) to PCR amplification, purification, sequencing, and BI report.
Bacteria
For bacteria, PCR of 16S rRNA genes is performed using 27F and 1492R primers, and sequencing is conducted using 785F
and 907R primers, which are the inter-primers, to identify bacteria. If the customer requests,
a primer can be additionally selected/changed and about 1,350 bp or longer sequences can be provided.
The default 2rxn (785F, 907R) is selected to allow more primer runs if desired.
Fungi
1,600 bp or higher results are guaranteed by the sequencing of the 18S rRNA region.
500 bp or longer results are guaranteed by the sequencing of ITS region.
1,300bp or longer results are guaranteed by the sequencing of 28S rRNA gene (D1/D2/D3 region).
Fragment Analysis
Fragment Analysis encompasses a wide variety of genotyping, DNA profiling, and mutation detection techniques for a/an medical, environmental, and agricultural research.
Psomagen Corp. provides the Fragment Analysis based on our accumulated experiences and knowledge in genomics.
In general, this service is used to only check amplified fragment sizes.
As PCR amplification is not available through this service, fluorescent-labeled PCR products should be supplied as Microsatellite Analysis (VNTRs) samples.
- Fragment Analysis Service Revision Notice
- Starting from January 2022, Psomagen will be concentrating our service to internal size standards 500 LIZ and 1200 LIZ only. We will no longer be providing size standards 120ROX, 350ROX, 400HD, and 600LIZ.
- Service Applications
- · Microsatellite Instability
· Amplified Fragment Length Polymorphism (AFLP) Analysis
· Terminal Restriction Fragment Length Polymorphism (T-RFLP) Analysis
· Relative Fluorescent Quantization - Loss of Heterozygosity (LOH), Aneuploidy Assays, and Large Chromosomal Deletion Detection
· Sequence-related amplified polymorphism (SRAP) provides a useful tool for estimation of genetic diversity and phenetic relationships in natural and domesticated populations
- Service Type
- · Standard Run
- Client will submit fluorescent labeled PCR Products.
- Client will select internal size standard: 500LIZ or 1200 LIZ.
· Run-Only
- Client will submit premix of fluorescent labeled PCR products, Hi-Di Formamide, and G5 Dye Set size standard.
- Requirements
- · PCR Product Concentration: 10-20 ng/ul
· Sample volume: 20 ul
· When preparing for shipment, all samples should be covered with light-restricting materials such as an aluminum foil and packaged with dry ice/cold packs.
- Which Dye Should I Use?
-
Dye Set G5 Blue 6-FAM Green VIC Yellow NED Blue PET Internal Standard Size Marker
(Maximum detection size)500 LIZ(500bp) 1,200 LIZ(1,200bp)
- What Data To Receive?
- · 3730xl Raw Data (.fsa) / extra charge_ Size standard-1200LIZ
· Peaks of allele (.pdf) and genotype table (Excel) is available upon request for additional charge.
-
- Turn Around Time & Sample Storage
- · Standard Run: 3-4 Business days.
· Condition Optimization: 4-5 Business days.
· Condition Optimization Service (Available Upon Request) - Pre-QC for new clients or existing clients with a new set of samples/project to ensure most compatible condition between the samples and the instruments.
· All submitted samples will be stored for 5 days from the date of arrival.
- 1. Online Ordering System:
- We highly recommend using our online ordering system (LIMS) where you can easily place an order and make a payment. Please visit our website lims.psomagen. com and open an account to start placing an order. If having a hard time placing an order please email customerservice@psomagen.com
- · Log in → Go to “Place an Order” → Choose service → Step 1 Enter basic information → Step 2 Reaction Info → Step 3 Sample Info → Step 4 Primer Condition → Step 5 Billing information → Choose payment method → Choose delivery type → Print confirmation page → Include the printout with the sample package → Ship or drop off samples
Shipping samples
- - Shipping by mail
-
· Ship your samples to :
Psomagen Maryland HQ
1330 Piccard Dr. Suite 103, Rockville, MD 20850
(All US states except for NJ, NY, and MA)
Psomagen New York Facility
760 Parkside Ave Suite 122, Brooklyn, NY 11226
(For NJ, NY and international customers)
Psomagen Massachusetts Facility
10 Rogers Street Unit 1A, Cambridge, MA 02142
(For MA)
-
· Shipping coverage is $30 for every 20 reactions or each 96-well plate (Maximum shipping coverage is $90).
· Select delivery type as "Standard Overnight".
Dry ice or ice packs are not necessary in the shipment unless you are sending cultured/uncultured cell.
- - Sample drop boxes & Pick up service
-
· We currently have drop off locations at various institutions.
You can check the available drop box location when you place an order.
-
· Please contact us for the availability of sample drop box near you.
- customerservice@psomagen.com, 301-251-1007 ext. 302
- - Sample pick up at the Bethesda NIH campus
-
We provide daily pickup service for NIH customers at Bethesda campus.
If you are at our drop box locations (BLD 33, 35, 49, 50),
please drop off your samples before 2PM to ensure your sample pickup. For building number (BLG 4,5,6,8,9,10),
please place an online order before 2 PM if you would like to request pickup online or call the office at 301-251-1007 to schedule a pickup.
Our courier visits the campus from 2PM to 4 PM every weekday.
- - Drop off samples at our facility before 5:00 pm to get your results back next morning.
-
Maryland Lab
· Drop box can be found at the South entrance of the building.
· Please call us for direction at 301-251-1007.
1330 Piccard Drive
Rockville, MD 20850 -
Massachusetts Lab
· Drop box can be found at the main entrance of Unit 1A.
· Please call us for direction at 301-251-1007.
10 Rogers Street Unit 1A
Cambridge, MA 02142 -
New York Lab
· Drop box can be found at Suite 122.
· Please call us for direction at 301-251-1007.
760 Parkside Ave. Suite 122
Brooklyn, NY 11226
Turnaround Time
-
· Sequencing results are available within 12 to 24 hours upon the sample arrival at Psomagen facility.
· If you request primer synthesis service with your sequencing order, the result will take 2-3 business days.
· Plasmid preparation and any additional services may take 1-2 business days before proceeding with sequencing reaction.
Sample Submission Guide
Samples and primers can be submitted in 1.5 ml tubes, strip tubes or 96 well PCR plates.
As for the DNA samples in water or TE, bacterial cells in agar-stab, or agar plate culture, temperature control is not necessary.
Samples are stable for a few days at room temperature.
- a) Single tube order :
-
· Agar-stab/Agar-plate culture can be shipped at room temperature.
· Glycerol stock should be enclosed with dry ice.
· We recommend to send samples/primers in 1.5ml Microcentrifuge tubes.
· Complimentary re-sequencing service is included if failed reactions are verified with reasonable reasons.
- b) Plate order:
-
· We recommend 8 strip caps to seal the plates.
* -U-bottom and Flat-bottom plate are not accepted.
If you would like to use multiple primers with your plate order, the most cost-effective method is to provide “Mirror” plate of samples and primers.
· Re-sequencing is additionally charged.
* Note : Please prepare samples to avoid any well-to-well concentration difference or size difference for quality results.
- c) Primer :
-
· Universal primers are provided for free of charge (ex. M13F, T7, T3)
· We have primer design and synthesis service.
- - Sealing of 96 Well Plates
-
· Strip caps are recommended to seal 96-well plates.
· Carefully seal the 96 well plates with strip caps (8-strips or 12-strips) or polypropylene films (relatively thick and malleable).
· Aluminum sealing or polyester films are not recommended.
-
Place samples into strip-capped well plate as shown below.
To avoid potential damage, please use out-skirted well plate.
- Seal tightly to avoid sample evaporation or contamination during transit.
- Unsatisfactory results due to improper sample preparation or shipping by customer will be charged for re-sequencing.
Sample Preparation
The quality of DNA is the single most important factor in obtaining high quality sequence data.
To ensure proper concentration, please check your samples by electrophoresis prior to shipping. There should be a single clear band of the appropriate size when loading 1 µl of the sample on a 1% agarose gel with EtBr. Smearing or multi-bands can be causal factors in sequencing failures. Using UV absorbance to quantify DNA may provide inaccurate measurements of target DNA concentration.
DNA should be dissolved in Nuclease-Free distilled water. Nuclease-Free super low EDTA TE buffer (10mM Tris-HCI, pH8.0, 0.01mM EDTA) can be used but with caution. If the TE buffer with EDTA (concentration of 0.1-1Mm) is used for dissolving DNA, EDTA take up free magnesium ions, which reduces DNA polymerase activity resulting in sequencing reaction failure.
- Sequencing Sample/Primer Requirements
- Samples and primers can be submitted in 1.5 ml tubes, strip tubes or 96-well PCR plates.
| Sample Type/Format | DNA size | Concentration | Volume | |
|---|---|---|---|---|
| Plasmid | 4 ~ 8kb | 80 ~ 150 ng/µl | 10 µl per reaction | |
| 8 ~ 15kb | 150 ~ 200 ng/µl | |||
| PCR Product | Less than 300bp | 10 ~ 20 ng/µl | ||
| 300bp ~ 700bp | 20 ~ 30 ng/µl | |||
| 700bp ~ 1kb | 30 ~ 50 ng/µl | |||
| 1kb ~ 4kb | 50 ~ 100 ng/µl | |||
| Over 4kb | See Plasmid | |||
| BAC | 40 ~ 200kb | 500 ~ 1000 ng/µl | 15 µl per reaction | |
| gDNA | - | 30 ~ 50 ng/µl | 15 µl per sample | |
| Whole Plasmid Sequencing | Up to 30kb | 50 ng/µl | 15 µl per sample | |
| Premix | Plasmid | - | 100 ng/µl | 5 µl sample + 5 µl primer |
| Purified PCR Product | - | 50 ng/µl | ||
| Primer | - | 5 pmol/µl | ||
| Sample Type/Format | DNA size | Concentration | Volume |
|---|---|---|---|
| Primer for regular sequencing | 18 ~ 27 mer(Tm 55℃ - 60℃) | 2 ~ 5 pmol/µl | 10 µl per reaction |
| Primer for BAC sequencing | 100 pmol/µl |
- A temperature control is not necessary in the below cases. Samples are stable for a few days at room temperature.
-
· DNA samples in water or TE
· Bacterial cells in agar-stab or agar plate culture
Print FedEx & DHL Label & Commercial Invoice & Letter of Acceptance
We provide the shipping protocol to make all users of Psomagen’s life easier!
Air waybills and commercial invoices will be provided to you in a few clicks through this protocol.
As your account carries all of your shipping information, sender information will be automatically submitted to you.
You can also save up to three different addresses for your future orders.
You are able to print the waybill, the commercial invoice and the letter of acceptance with all shipping details already entered according to the waybill information when you click the Continue button.
When all three steps have been completed, call your local FedEx or DHL to request for pickup!
Don’t worried about the safe arrival of your samples after dispatching,
we have the monitoring system for the packages that you send us to promptly resolve all the problems happened during shipping.
Psomagen Sequencing Troubleshooting guide
Most of sequencing failure is caused by sample condition or the specificity of composition, in this case there is no possibility of improvement through any other approach use, and therefore it is not the case of reanalysis Psomagen sequencing policy. The patterns in problems have been summarized to help user's understanding in sequencing data.
Psomagen Policies for retesting
The objective of reanalysis in Psomagen sequencing service is to confirm the possibility of machine' error, operator's mishandling, and only reanalysis is carried out in the case of that improvement is expected. Therefore, sending a sample from a new batch is not considered the subject for reanalysis even though it is the same name. The following failures caused by template preparation or composition should be fully paid for the analysis service.
Trouble Shooting Guide
No Signal
- Pattern
-
· Peaks are irregular and may appear as if it is just mixed peaks. However, such peaks are actually not normal peaks but just noise signal.
· The signal strength is less than 500.
- Cause
-
· The concentration of DNA is too low.
· The concentration of primer is too low or Tm is inappropriate for the sequencing reaction.
· The primer binding site is not on the sequence of sample DNA.
- Action
-
-
·To get fine sequencing result, the sample concentration is required as below;
- Plasmid DNA (high copy number) ; 100-150 ng/ul
- PCR product ; 25-50 ng/ul
- When you check the sample concentration by gel electrophoresis, the band should be present on a gel
if you load a sample on 1% agarose gel using 1ul of the sample. - ·Provide the primer at 5 pmole/ul or 10pmole/ul.
- ·The annealing temperature for sequencing reaction is 50℃(fixed) so Tm is recommended around 55-60℃.
- ·Check whether the primer binding site exists on the sequence of sample DNA.
- ·In case of plasmid, compare the sequence between the sequencing primer and the vector to confirm whether the primer binding site exists.
-
·Especially for primer M13R and M13R-pUC(-40), there is a difference between vector providers for primer names,
so it is required to check the sequence all the time whether the primer´s sequence is on the sequence of the sample.
- Primer M13R ; GCGGATAACAATTTCACACAGG
- Primer M13R-pUC(-40) ; CAGGAAACAGCTATGAC
* The primer binding site might be damaged. We would like to recommend that you try to use an alternative primer.
-
·To get fine sequencing result, the sample concentration is required as below;
No Signal
Mixed Template
- Pattern
-
- ·In case of plasmid, multiple peaks appear from the beginning of insertion position although clear peaks are shown up to vector position.
-
·In case of PCR product, the following aspects appear depending on what kind of non-specific PCR product is.
- - If the mixed non-specific PCR product has a similar size with the expected PCR product ;
The mixed peaks are present from the beginning to the end. In case two PCR products have similar sizes, it can be shown as if it is a single band on an agarose gel. - -If the mixed non-specific PCR product is with Insertion or deletion;
Sequence becomes mixed at position of Insertion or deletion although clean peaks are present in the beginning.
For most cases, such non-specific PCR product is longer or shorter just several bases than the expected PCR product,
this also can be shown as if it is single band on a agarose gel.
- - If the mixed non-specific PCR product has a similar size with the expected PCR product ;
- Cause
-
· This is because two colons were picked at the same time during Plasmid DNA preparation.
· This is because PCR products contain non-specific PCR products.
- Action
- · Preparing a new DNA sample is recommended.
Mixed template_2plasmids
Mixed template_2PCR products
Mixed template_general case
Compression
- Pattern
- · Multiple peaks appear from a certain point.
- Cause
-
-
·Compression occurs due to DNA fragments of different sizes with the same electrophoretic mobility.
This phenomenon is thought to be caused by regions of secondary structure within the template DNA
and as different peaks are detected simultaneously it appears as multi-peaks and although it rarely happens,
but it can be found in the regions with a high G/C or high A/T content.
-
·Compression occurs due to DNA fragments of different sizes with the same electrophoretic mobility.
- Action
- · Confirm whether the result is improved by using the opposite direction primer.
Compression
Multiple Binding
- Pattern
- · Multiple peaks appear at a different position with good signal strength.
- Cause
-
- ·If accidentally more than 2 regions have homology for the primer binding sequence the primer has multiple bindings although the template is one.
-
·When more than 2 different templates are mixed this phenomenon appears.
When 2 PCR products with similar sizes are mixed, it looks like a single band on the agarose gel..
- Action
-
· Design a long primer or design a new primer being able to avoid multiple binding.
· The use of an opposite direction primer can be helpful.
· If more than 2 similar sized products are mixed, redo PCR in a more optimized PCR.
Multiple Binding
Slippage
- Pattern
- · The phenomenon that mixed peaks appear in the back position of a long homopolymer region.
- Cause
- · Pairing occurs incorrectly in homopolymer region during polymerization.
- Action
-
· Try sequencing in both directions. For example, if a slippage pattern appears when the reverse primer is used, try sequencing toward the forward direction.
· Perform sequencing by designing a new primer avoiding homopolymer region.
Slippage
Mixed base
- Pattern
- · Partly 1 base peak appears as a double peak in the normal sequencing data.
- Cause
- · It can be caused by SNP or rarely point mutation.
- Action
- · Compare the reaction results after several runnings if base calling is suspected.
Mixed base
N-1 Primer
- Pattern
-
· Small peaks appear on the whole as like background.
· Lower peaks from the base which is the same as the major peaks are shown right before major peaks.
- Cause
-
· Primer purification was not done properly during synthesis processes.
· The primer was degraded.
· The primer binding site in the sample is not appropriate.
- Action
-
· Mostly, this phenomenon is caused by primer purification or degradation. The clear results can be obtained by sequencing with the primer resynthesized.
· Degradation can be confirmed by Psomagen MALDI (Matrix-assisted laser desorption/ionization) and Psomagen offers the service.
(When employing oligonucleotides prepared 6 months or around 1 year ago check whether the degradation occurs
before use or use oligonucleotides newly synthesized.
N-1 Primer(Before the improvement)
N-1 Primer(After the improvement)
Frameshift Mutation
- Pattern
-
· Minor peaks, the same as N-1 primer pattern appears from a certain point
· The difference from N-1 primer is whereas N-1 peak appears from right after primer binding in case of N-1 primer it appears
from the middle point in case of Frameshift Mutation.
- Cause
- · Several products are made in a sample because one or more than one base is inserted or deleted in a template.
- Action
- · Sample DNA should be newly prepared.
Frameshift Mutation
Repeat Sequencing
- Pattern
- · It is the phenomenon that the peaks in back portion are overlapped due to the repetitive sequence (the repetition of 2 or more bases is shown).
- Cause
- · It is thought that polymerase processing is interfered by repetitive sequence or the secondary structure is formed.
- Action
-
· Use the Difficult sequencing service of Psomagen.
Difficult sequencing service of Psomagen is specialized for the case of signal decrease or sudden signal loss caused by unusual secondary structure or high GC sequence.
Repeat Sequencing
Abrupt Signal loss
- Pattern
- · Peaks are suddenly stopped or rapidly lower. Whereafter data are not gained.
- Cause
- There is secondary structure existed in the sample.
- Action
-
· Perform sequencing toward the opposite direction of the corresponding result.
· Use the Difficult sequencing service of Psomagen. Difficult sequencing service of Psomagen is specialized for signal decrease or sudden signal loss caused
by unusual secondary structure or high GC sequence.
Abrupt signal loss(Before the improvement)
Abrupt signal loss(After the improvement)
Dye Blob
- Pattern
- · One or more peaks appear as wider and over-intensified peaks, commonly between 50 and 140.
- Cause
-
· This phenomenon can be shown when the sample volume is not used properly, based on the sample concentration.
· Very small quantity of BigDye left in the clean up process appears as large dye blob peaks.
· A small amount of Big Dye remains in the Clean-up process and appears as a large dye blob peaks.
- Action
- · Reduce the error as measuring the sample concentration by a gel electrophoresis and spectrophotometer.
Dye Blob
| Name | Sequence(5'-3') | Name | Sequence(5'-3') |
1. Access your result page by clicking “Result” and “CES”
2. Click “Previous Order”
3. Click on the corresponding “Report” tab to see your sequence data
